pOD2048-csnDEG
(Plasmid
#89368)
-
PurposeMosSCI targeting vector expressing a fusion between a GFP nanobody and ubiquitin ligase adaptor ZIF-1 to degrade GFP tagged proteins. Expression controlled by Posm-6 (ciliated sensory neuron specific)
-
Depositing Lab
-
Sequence Information
-
Sequences (1) — Accept Affinity Reagent Sequence Policy
-
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 89368 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepCFJ151
-
Backbone manufacturerChristian Frøkjær-Jensen (Erik Jorgensen lab)
- Backbone size w/o insert (bp) 7328
- Total vector size (bp) 11594
-
Vector typeTargeting vector for Mos1 transposon mediated single copy transgene insertion
-
Selectable markersCb-unc-119(+)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namevhhGFP4-ZIF-1
-
SpeciesC. elegans (nematode), Synthetic
-
Insert Size (bp)2098
-
Entrez Genezif-1 (a.k.a. CELE_F59B2.6)
- Promoter Posm-6
-
Tag
/ Fusion Protein
- vhhGFP4 (GFP nanobody) (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer tgtaaaacgacggccagt
- 3′ sequencing primer CGACTCACTAGTGGGCAGAT (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pOD2048-csnDEG was a gift from Karen Oegema (Addgene plasmid # 89368 ; http://n2t.net/addgene:89368 ; RRID:Addgene_89368) -
For your References section:
A toolkit for GFP-mediated tissue-specific protein degradation in C. elegans. Wang S, Tang NH, Lara-Gonzalez P, Zhao Z, Cheerambathur DK, Prevo B, Chisholm AD, Desai A, Oegema K. Development. 2017 Jun 15. pii: dev.150094. doi: 10.1242/dev.150094. 10.1242/dev.150094 PubMed 28619826
Map uploaded by the depositor.