pLL3.7m-psCDK5
(Plasmid #89365)

• Purpose: A lenti-viral vector expressing photoswitchable CDK5 in mammalian cells
• Depositing Lab: Michael Lin
• Publication: Zhou et al Science. 2017 Feb 24;355(6327):836-842. doi: 10.1126/science.aah3605.

Backbone

• Vector backbone: pLL3.7m
• Backbone manufacturer: Luk Parijs
• Backbone size w/o insert (bp): 6500
• Modifications to backbone: 5' and 3' UTRs of HIV transcript reduced while retaining essential packaging elements
• Vector type: Mammalian Expression, Lentiviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: psCDK5
• Alt name: photoswitchable CDK5
• Alt name: photoswitchable cyclin-dependent kinase 5
• Species: H. sapiens (human), Synthetic
• Entrez Gene: CDK5 (a.k.a. LIS7, PSSALRE)
• Promoter: CMV
• Tags / Fusion Proteins:
  • pdDronpa
  • Human influenza hemagglutinin (HA) tag (N terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: CGGATAACAATTTCACACAG
• 3′ sequencing primer: CGGCCTTTTTACGGTTCCTG

Resource Information

• Supplemental Documents:
  • pLL3.7m-psCDK5.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry