Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pMCB306
(Plasmid #89360)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 89360 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pSicoR
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    GFP, puromycin resistance
  • gRNA/shRNA sequence
    GACCAGGATGGGCACCACCC

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

pMCB306 was originally derived from pU6-sgGFP-NT1 (addgene #46914) from the Weissman and Qi labs

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMCB306 was a gift from Michael Bassik (Addgene plasmid # 89360 ; http://n2t.net/addgene:89360 ; RRID:Addgene_89360)
  • For your References section:

    Synergistic drug combinations for cancer identified in a CRISPR screen for pairwise genetic interactions. Han K, Jeng EE, Hess GT, Morgens DW, Li A, Bassik MC. Nat Biotechnol. 2017 Mar 20. doi: 10.1038/nbt.3834. 10.1038/nbt.3834 PubMed 28319085