Skip to main content
Addgene

pMCB320
(Plasmid #89359)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 89359 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pMCB306; mCherry is in place of GFP
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    puromycin resistance, mCherry
  • gRNA/shRNA sequence
    GACCAGGATGGGCACCACCC

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

pMCB320 is modified from pMCB306, which was originally derived from pU6-sgGFP-NT1 (addgene #46914) from the Weissman and Qi labs

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMCB320 was a gift from Michael Bassik (Addgene plasmid # 89359 ; http://n2t.net/addgene:89359 ; RRID:Addgene_89359)
  • For your References section:

    Synergistic drug combinations for cancer identified in a CRISPR screen for pairwise genetic interactions. Han K, Jeng EE, Hess GT, Morgens DW, Li A, Bassik MC. Nat Biotechnol. 2017 Mar 20. doi: 10.1038/nbt.3834. 10.1038/nbt.3834 PubMed 28319085