pcDNA3.1-hAsCpf1(TATV) (pY220)
(Plasmid #89353)

• Purpose: Expresses humanized AsCpf1 variant that recognizes TATV PAMs
• Depositing Lab: Feng Zhang
• Publication: Gao et al Nat Biotechnol. 2017 Jun 5. doi: 10.1038/nbt.3900.

Backbone

• Vector backbone: pcDNA3.1
• Backbone size w/o insert (bp): 5402
• Total vector size (bp): 9509
• Vector type: Mammalian Expression, CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Cpf1, RVR variant
• Alt name: AsCas12a RVR variant
• Species: Synthetic; Acidaminococcus sp.
• Insert Size (bp): 4107
• Mutation: S542R/K548V/N552R
• Promoter: CMV
• Tags / Fusion Proteins:
  • NLS (N terminal on insert)
  • NLS-3xHA (C terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: CGCAAATGGGCGGTAGGCGTG

Resource Information

• Supplemental Documents:
  • pcDNA3.1-CMV-NLS-hAsCpf1(RVR)-NLS-3xHA.gb
• Articles Citing this Plasmid:
  • 3 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

This variant also recognizes TTTV and RATR PAMs (R = A or G).

For more information on Zhang lab CRISPR plasmids, please refer to www.addgene.org/crispr/zhang/.