Skip to main content
Addgene

TCRalpha_E2A_SP-SNAPf-TCRbeta_P2A_CD3e_T2A_CD3zeta
(Plasmid #89347)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 89347 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pHR
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Jurkat TCRalpha/beta alleles and CD3e and CD3z
  • Species
    H. sapiens (human)
  • Promoter SFFV

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer SFFV for (GCTTCCCGAGCTCTATAAAAGAGC)
  • 3′ sequencing primer WPRE rev (CCAGAGGTTGATTATCGATAAGC)
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    TCRalpha_E2A_SP-SNAPf-TCRbeta_P2A_CD3e_T2A_CD3zeta was a gift from Ron Vale (Addgene plasmid # 89347 ; http://n2t.net/addgene:89347 ; RRID:Addgene_89347)

  • For your References section:

    A DNA-Based T Cell Receptor Reveals a Role for Receptor Clustering in Ligand Discrimination. Taylor MJ, Husain K, Gartner ZJ, Mayor S, Vale RD. Cell. 2017 Mar 23;169(1):108-119.e20. doi: 10.1016/j.cell.2017.03.006. 10.1016/j.cell.2017.03.006 PubMed 28340336
Related items:
Commonly requested with: