pBJ 2358
(Plasmid
#89245)
-
PurposeExpresses YFP fused to the N-terminus of Mouse Capping Protein Alpha1, using the Clontech vector PEYFP C-1.
-
Depositing Lab
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 89245 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backbonepEYFP C-1
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 4700
- Total vector size (bp) 7700
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCapza1
-
Alt nameMouse Capping Protein Alpha1
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)3000
-
GenBank IDNM_009797.2
-
Entrez GeneCapza1 (a.k.a. CAPZ, CAZ1, Cappa1, capZ alpha-1)
- Promoter CMV
-
Tag
/ Fusion Protein
- YFP (N terminal on backbone)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer CATGGTCCTGCTGGAGTTCGTG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBJ 2358 was a gift from John Cooper (Addgene plasmid # 89245 ; http://n2t.net/addgene:89245 ; RRID:Addgene_89245) -
For your References section:
CPI motif interaction is necessary for capping protein function in cells. Edwards M, McConnell P, Schafer DA, Cooper JA. Nat Commun. 2015 Sep 28;6:8415. doi: 10.1038/ncomms9415. 10.1038/ncomms9415 PubMed 26412145
