pCW57-RFP-P2A-MCS (Neo)
(Plasmid #89182)

• Purpose: (Empty Backbone) All-in-one doxycycline inducible lentiviral vector for expression of one gene in combination with turbo RFP using the P2A self-cleaving peptide.
• Depositing Lab: Adam Karpf
• Publication: Barger et al Elife. 2021 Apr 23;10. pii: 55070. doi: 10.7554/eLife.55070.

Backbone

• Vector backbone: pCW57.1
• Backbone manufacturer: Broad Insitute
• Backbone size (bp): 8636
• Modifications to backbone: pCW57-MCS1-2A-MCS2 (Neo) was modified by the insertion of Turbo RFP into MCS1.
• Vector type: Mammalian Expression, Lentiviral ; Doxycycline inducible; P2A Self Cleaving Peptide
• Promoter: TRE
• Selectable markers: Neomycin (select with G418) ; Turbo RFP

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ sequencing primer: pCW57.MCS_Seq_F CGTATGTCGAGGTAGGCGTG

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Evrogen Limited Use Label License for FPs
• Industry Terms:
  • Not Available to Industry