-
PurposeExpress Rotavirus SA11 NSP5 in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 89172 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonep3E5
- Backbone size w/o insert (bp) 3074
- Total vector size (bp) 3741
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameRotavirus SA11 NSP5
-
SpeciesRotavirus SA11
-
Insert Size (bp)667
-
GenBank IDLC178574
- Promoter T7 promotor
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer T7 forward CTGTGGATAACCGTATTACCG
- 3′ sequencing primer T7 terminal GCTAGTTATTGCTCAGCGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pT7-NSP5SA11 was a gift from Takeshi Kobayashi (Addgene plasmid # 89172 ; http://n2t.net/addgene:89172 ; RRID:Addgene_89172) -
For your References section:
Entirely plasmid-based reverse genetics system for rotaviruses. Kanai Y, Komoto S, Kawagishi T, Nouda R, Nagasawa N, Onishi M, Matsuura Y, Taniguchi K, Kobayashi T. Proc Natl Acad Sci U S A. 2017 Jan 30. pii: 201618424. doi: 10.1073/pnas.1618424114. 10.1073/pnas.1618424114 PubMed 28137864