Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pT7-NSP2SA11
(Plasmid #89169)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 89169 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    p3E5
  • Backbone size w/o insert (bp) 3074
  • Total vector size (bp) 4133
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Rotavirus SA11 NSP2
  • Species
    Rotavirus SA11
  • Insert Size (bp)
    1059
  • GenBank ID
    LC178571
  • Promoter T7 promotor

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer T7 forward CTGTGGATAACCGTATTACCG
  • 3′ sequencing primer T7 terminal GCTAGTTATTGCTCAGCGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pT7-NSP2SA11 was a gift from Takeshi Kobayashi (Addgene plasmid # 89169 ; http://n2t.net/addgene:89169 ; RRID:Addgene_89169)
  • For your References section:

    Entirely plasmid-based reverse genetics system for rotaviruses. Kanai Y, Komoto S, Kawagishi T, Nouda R, Nagasawa N, Onishi M, Matsuura Y, Taniguchi K, Kobayashi T. Proc Natl Acad Sci U S A. 2017 Jan 30. pii: 201618424. doi: 10.1073/pnas.1618424114. 10.1073/pnas.1618424114 PubMed 28137864