-
PurposeExpress vaccinia virus D1R in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 89160 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepCAGGS
- Backbone size w/o insert (bp) 5713
- Total vector size (bp) 8248
-
Vector typeMammalian Expression
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameVaccinia virus D1R
-
SpeciesVaccinia virus
-
Insert Size (bp)2535
- Promoter CAG promotor
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CTAGAGCCTCTGCTAACCATGTTC
- 3′ sequencing primer TCAGTGGTATTTGTGAGCCAGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCAG-D1R was a gift from Takeshi Kobayashi (Addgene plasmid # 89160 ; http://n2t.net/addgene:89160 ; RRID:Addgene_89160) -
For your References section:
Entirely plasmid-based reverse genetics system for rotaviruses. Kanai Y, Komoto S, Kawagishi T, Nouda R, Nagasawa N, Onishi M, Matsuura Y, Taniguchi K, Kobayashi T. Proc Natl Acad Sci U S A. 2017 Jan 30. pii: 201618424. doi: 10.1073/pnas.1618424114. 10.1073/pnas.1618424114 PubMed 28137864