pFS478
(Plasmid #89066)

• Purpose: KanMX Z3EV promoter cassette
• Depositing Lab: Nick Rhind
• Publication: Ohira et al Yeast. 2017 Aug;34(8):323-334. doi: 10.1002/yea.3235. Epub 2017 Jun 8.

Backbone

• Vector backbone: pFS6a-KanMX6-P3nmt1
• Backbone manufacturer: Bahler et al, Yeast, 14(10) 943-51, 1998
• Backbone size w/o insert (bp): 5100
• Total vector size (bp): 4654
• Modifications to backbone: replaced nmt1 promoter in backbone with Z3EV promoter
• Vector type: Yeast integration vector
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Z3EV promoter cassette
• Species: Synthetic
• Insert Size (bp): 699
• Mutation: yeast Gal1 promoter modified with multiple Zif268 binding sites
• Promoter: Z3EV promoter

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: acagatctcgccataaa
• 3′ sequencing primer: ttaaagacatgatttaacaa

Resource Information

• Supplemental Documents:
  • pFS478.gb
• A portion of this plasmid was derived from a plasmid made by: McIsaac, R.S. et al., 2011. Fast-acting and nearly gratuitous induction of gene expression and protein depletion in Saccharomyces cerevisiae. Molecular biology of the cell, 22(22), pp.4447–59. McIsaac, R.S. et al., 2014. Synthetic biology tools for programming gene expression without nutritional perturbations in Saccharomyces cerevisiae. Nucleic Acids Research, 42(6), pp.1–8.
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry