pFS462
(Plasmid #89065)

• Purpose: his7 integration plasmid with Z3EVpr:GFP
• Depositing Lab: Nick Rhind
• Publication: Ohira et al Yeast. 2017 Aug;34(8):323-334. doi: 10.1002/yea.3235. Epub 2017 Jun 8.

Backbone

• Vector backbone: pBSSK-His7(F)
• Backbone manufacturer: Apolinario, E., Nocero, M., Jin, M., & Hoffman, C. S. (1993). Current Genetics, 24(6), 491–495.
• Backbone size w/o insert (bp): 5763
• Total vector size (bp): 7503
• Modifications to backbone: Added Z3EV promoter, GFP-NLS CDS, and leu1 C-terminal 300nt
• Vector type: S. pombe his7 integration vector
• Selectable markers: S. pombe his7

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Z3EV promoter GFP-NLS leu1 C-terminal 300 nt
• Species: Synthetic
• Insert Size (bp): 1740
• Promoter: Z3EV

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: agattccccatggaaggaag
• 3′ sequencing primer: attcctattgcaatgggctt

Resource Information

• Supplemental Documents:
  • pFS462.gb
• A portion of this plasmid was derived from a plasmid made by: McIsaac, R.S. et al., 2011. Fast-acting and nearly gratuitous induction of gene expression and protein depletion in Saccharomyces cerevisiae. Molecular biology of the cell, 22(22), pp.4447–59. McIsaac, R.S. et al., 2014. Synthetic biology tools for programming gene expression without nutritional perturbations in Saccharomyces cerevisiae. Nucleic Acids Research, 42(6), pp.1–8.
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry