Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

1183_pAAV-U6-Ex14-gRNAd-CB-EmGFP
(Plasmid #89061)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 89061 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pEMBL8
  • Backbone size w/o insert (bp) 2508
  • Total vector size (bp) 4596
  • Vector type
    Mammalian Expression, AAV, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    Confirm ITR's remain intact with XmaI, SnaBI, PvuII digests
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    EmGFP
  • gRNA/shRNA sequence
    TGCTGCTGGCCAAGGACATG
  • Species
    Aequorea Victoria
  • Promoter Chicken beta actin with partial CMV enhancer

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NcoI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer CCTTCATATTTGCATATACGATACAAGGCTGTTAG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    1183_pAAV-U6-Ex14-gRNAd-CB-EmGFP was a gift from William Lagor (Addgene plasmid # 89061 ; http://n2t.net/addgene:89061 ; RRID:Addgene_89061)
  • For your References section:

    Somatic genome editing with CRISPR/Cas9 generates and corrects a metabolic disease. Jarrett KE, Lee CM, Yeh YH, Hsu RH, Gupta R, Zhang M, Rodriguez PJ, Lee CS, Gillard BK, Bissig KD, Pownall HJ, Martin JF, Bao G, Lagor WR. Sci Rep. 2017 Mar 16;7:44624. doi: 10.1038/srep44624. 10.1038/srep44624 PubMed 28300165