Skip to main content
Addgene

pTE4566
(Plasmid #88904)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 88904 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pcDNA3.1
  • Backbone size w/o insert (bp) 4257
  • Total vector size (bp) 9948
  • Vector type
    Mammalian Expression, CRISPR
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    Mb crRNA
  • Alt name
    Moraxella bovoculi CRISPR RNA
  • Insert Size (bp)
    48
  • Promoter human U6

Cloning Information for Gene/Insert 1

  • Cloning method Unknown
  • 5′ sequencing primer AAAACAGGAAGGCAAAATGC
  • 3′ sequencing primer ggtcgggcaggaagaggg
    • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    hMbCpf1(D986A)
  • Alt name
    humanized Moraxella bovoculi Cpf1 nuclease, D986A inactive/dead mutant
  • Insert Size (bp)
    4119
  • Promoter CMV
  • Tags / Fusion Proteins
    • NLS (C terminal on insert)
    • 3xHA (C terminal on insert)

Cloning Information for Gene/Insert 2

  • Cloning method Unknown
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer TAGAAGGCACAGTCGAGG
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTE4566 was a gift from Ervin Welker (Addgene plasmid # 88904 ; http://n2t.net/addgene:88904 ; RRID:Addgene_88904)

  • For your References section:

    Mb- and FnCpf1 nucleases are active in mammalian cells: activities and PAM preferences of four wild-type Cpf1 nucleases and of their altered PAM specificity variants. Toth E, Czene BC, Kulcsar PI, Krausz SL, Talas A, Nyeste A, Varga E, Huszar K, Weinhardt N, Ligeti Z, Borsy AE, Fodor E, Welker E. Nucleic Acids Res. 2018 Sep 20. pii: 5103950. doi: 10.1093/nar/gky815. 10.1093/nar/gky815 PubMed 30239882
Related items:
Commonly requested with: