Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

MSCV Puro SCRIB P305L
(Plasmid #88887)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 88887 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pMSCV
  • Backbone size w/o insert (bp) 6
  • Total vector size (bp) 11330
  • Vector type
    Retroviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    SCRIB
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    5
  • Mutation
    Proline to Leucine mutation @ 305th amino acid
  • GenBank ID
    NM_182706
  • Entrez Gene
    SCRIB (a.k.a. CRIB1, SCRB1, SCRIB1, Vartul, oSCRIB)
  • Promoter MSCV promoter

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer CCCTTGAACCTCCTCGTTCGACC
  • 3′ sequencing primer CAGCGGGGCTGCTAAAGCGCATGC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Weiyue Zhang - University Health Network (UHN) @ The Princess Margaret Cancer Center

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    MSCV Puro SCRIB P305L was a gift from Senthil Muthuswamy (Addgene plasmid # 88887 ; http://n2t.net/addgene:88887 ; RRID:Addgene_88887)
  • For your References section:

    An interaction between Scribble and the NADPH oxidase complex controls M1 macrophage polarization and function. Zheng W, Umitsu M, Jagan I, Tran CW, Ishiyama N, BeGora M, Araki K, Ohashi PS, Ikura M, Muthuswamy SK. Nat Cell Biol. 2016 Nov;18(11):1244-1252. doi: 10.1038/ncb3413. Epub 2016 Oct 3. 10.1038/ncb3413 PubMed 27694890