PGC-1 alpha promoter luciferase delta CRE
(Plasmid #8888)

• Depositing Lab: Bruce Spiegelman
• Publication: Handschin et al Proc Natl Acad Sci U S A. 2003 Jun 10. 100(12):7111-6.

Backbone

• Vector backbone: pGL3-basic
• Backbone manufacturer: Promega
• Backbone size w/o insert (bp): 4818
• Vector type: Mammalian Expression, Luciferase

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: PGC-1 alpha promoter dCRE
• Alt name: PGC1 promoter
• Alt name: PGC-1a promoter
• Species: M. musculus (mouse)
• Insert Size (bp): 2600
• Mutation: Site-directed mutagenesis to remove the CREB binding site.
• Entrez Gene: Ppargc1a (a.k.a. A830037N07Rik, Gm11133, PGC-1, PPARGC-1-alpha, Pgc-1alpha, Pgc1, Pgco1, Ppargc1)
• Tag / Fusion Protein:
  • luciferase (C terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: KpnI (not destroyed)
• 3′ cloning site: XhoI (not destroyed)
• 5′ sequencing primer: RVprimer3 (CTAGCAAAATAGGCTGTCCC)
• 3′ sequencing primer: GLprimer2 (CTTTATGTTTTTGGCGTCTTCCA)

Resource Information

• Articles Citing this Plasmid:
  • 10 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Luciferase Limited Use Label License
• Industry Terms:
  • Not Available to Industry

Depositor Comments

5' flanking sequence of mouse PGC-1 alpha gene PCR amplified between +78 and -2533 with respect to the transcriptional start site. Mutation of the CRE site between -146 and -129 from TGACGTCA to TAGATCTA.

NOTE: The full sequence from the depositor is theoretical. There are several discrepancies between Addgene's quality control sequence and the full sequence provided here, but those discrepancies do not appear to affect function. Several labs have published successfully with this plasmid.