-
PurposeCRISPR KO of Trp53
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 88853 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneLentiGuide-Puro
-
Vector typeMammalian Expression, Lentiviral, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameTrp53
-
gRNA/shRNA sequencegagcgctgctcagatagcga
-
SpeciesH. sapiens (human)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
LentiGuidPuro-hTP53_sgRNA-1 was a gift from Joan Massague (Addgene plasmid # 88853 ; http://n2t.net/addgene:88853 ; RRID:Addgene_88853) -
For your References section:
The p53 Family Coordinates Wnt and Nodal Inputs in Mesendodermal Differentiation of Embryonic Stem Cells. Wang Q, Zou Y, Nowotschin S, Kim SY, Li QV, Soh CL, Su J, Zhang C, Shu W, Xi Q, Huangfu D, Hadjantonakis AK, Massague J. Cell Stem Cell. 2017 Jan 5;20(1):70-86. doi: 10.1016/j.stem.2016.10.002. Epub 2016 Nov 23. 10.1016/j.stem.2016.10.002 PubMed 27889317