Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pFUGW-ZipACR-EYFP
(Plasmid #88844)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 88844 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pFUGW
  • Backbone size w/o insert (bp) 3099
  • Total vector size (bp) 4757
  • Modifications to backbone
    None
  • Vector type
    Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ZipACR-NotI-EYFP
  • Species
    Proteomonas sulcata
  • Insert Size (bp)
    1658
  • GenBank ID
    KX879679 KX879679
  • Tag / Fusion Protein
    • EYFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer TGAACTATGCGCTCGGGGTTGGCG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pFUGW-ZipACR-EYFP was a gift from John Spudich (Addgene plasmid # 88844 ; http://n2t.net/addgene:88844 ; RRID:Addgene_88844)
  • For your References section:

    The Expanding Family of Natural Anion Channelrhodopsins Reveals Large Variations in Kinetics, Conductance, and Spectral Sensitivity. Govorunova EG, Sineshchekov OA, Rodarte EM, Janz R, Morelle O, Melkonian M, Wong GK, Spudich JL. Sci Rep. 2017 Mar 3;7:43358. doi: 10.1038/srep43358. 10.1038/srep43358 PubMed 28256618