pFUGW-ZipACR-EYFP
(Plasmid #88844)

• Purpose: Fast anion channelrhodopsin (current half-decay time 2-4 ms depending on voltage) for time-resolved inhibition of neuronal spiking
• Depositing Lab: John Spudich
• Publication: Govorunova et al Sci Rep. 2017 Mar 3;7:43358. doi: 10.1038/srep43358.

Backbone

• Vector backbone: pFUGW
• Backbone size w/o insert (bp): 3099
• Total vector size (bp): 4757
• Modifications to backbone: None
• Vector type: Lentiviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: ZipACR-NotI-EYFP
• Species: Proteomonas sulcata
• Insert Size (bp): 1658
• GenBank ID: KX879679 KX879679
• Tag / Fusion Protein:
  • EYFP (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: TGAACTATGCGCTCGGGGTTGGCG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry