pLJC2-Rap2A-3xFLAG
(Plasmid
#87974)
-
Purpose3rd generation lentiviral vector for Expression of Rap2A in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 87974 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepLJC2
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameRAP2A
-
SpeciesH. sapiens (human)
-
Entrez GeneRAP2A (a.k.a. K-REV, KREV, RAP2, RbBP-30)
- Promoter CMV
-
Tag
/ Fusion Protein
- 3xFLAG (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site PacI (unknown if destroyed)
- 3′ cloning site NotI (unknown if destroyed)
- 5′ sequencing primer TGTACGGTGGGAGGTCTATATAAG
- 3′ sequencing primer CCCTTTTCTTTTAAAATTGTGGATGAATACTGCC (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLJC2-Rap2A-3xFLAG was a gift from David Sabatini (Addgene plasmid # 87974 ; http://n2t.net/addgene:87974 ; RRID:Addgene_87974) -
For your References section:
Physiologic Medium Rewires Cellular Metabolism and Reveals Uric Acid as an Endogenous Inhibitor of UMP Synthase. Cantor JR, Abu-Remaileh M, Kanarek N, Freinkman E, Gao X, Louissaint A Jr, Lewis CA, Sabatini DM. Cell. 2017 Apr 6;169(2):258-272.e17. doi: 10.1016/j.cell.2017.03.023. 10.1016/j.cell.2017.03.023 PubMed 28388410