Skip to main content
Addgene

pLJC1-Rap2A-3xFLAG
(Plasmid #87972)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 87972 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pLJC1
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    RAP2A
  • Species
    H. sapiens (human)
  • Entrez Gene
    RAP2A (a.k.a. K-REV, KREV, RAP2, RbBP-30)
  • Promoter CMV
  • Tag / Fusion Protein
    • 3xFLAG (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site PacI (unknown if destroyed)
  • 3′ cloning site NotI (unknown if destroyed)
  • 5′ sequencing primer TGTACGGTGGGAGGTCTATATAAG
  • 3′ sequencing primer CCTGGGGACGTCGTCGCGGGTGGC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLJC1-Rap2A-3xFLAG was a gift from David Sabatini (Addgene plasmid # 87972 ; http://n2t.net/addgene:87972 ; RRID:Addgene_87972)
  • For your References section:

    Physiologic Medium Rewires Cellular Metabolism and Reveals Uric Acid as an Endogenous Inhibitor of UMP Synthase. Cantor JR, Abu-Remaileh M, Kanarek N, Freinkman E, Gao X, Louissaint A Jr, Lewis CA, Sabatini DM. Cell. 2017 Apr 6;169(2):258-272.e17. doi: 10.1016/j.cell.2017.03.023. 10.1016/j.cell.2017.03.023 PubMed 28388410