pBABE puro Tusc5
(Plasmid
#87952)
-
Purposeretroviral plasmid containing mouse Tusc5
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 87952 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepBABE puro
- Backbone size w/o insert (bp) 5169
- Total vector size (bp) 5691
-
Vector typeRetroviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameTumor Suppressor Candidate 5
-
Alt nameTusc5, DSPB1, LOST1
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)522
-
Entrez GeneTusc5 (a.k.a. C130069F04Rik, DSPB1, Lost1)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CCTTGAACCTCCTCTTTCGACC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBABE puro Tusc5 was a gift from David James (Addgene plasmid # 87952 ; http://n2t.net/addgene:87952 ; RRID:Addgene_87952) -
For your References section:
Proteomic Analysis of GLUT4 Storage Vesicles Reveals Tumor Suppressor Candidate 5 (TUSC5) as a Novel Regulator of Insulin Action in Adipocytes. Fazakerley DJ, Naghiloo S, Chaudhuri R, Koumanov F, Burchfield JG, Thomas KC, Krycer JR, Prior MJ, Parker BL, Murrow BA, Stockli J, Meoli CC, Holman GD, James DE. J Biol Chem. 2015 Sep 25;290(39):23528-42. doi: 10.1074/jbc.M115.657361. Epub 2015 Aug 3. 10.1074/jbc.M115.657361 PubMed 26240143