Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pAAV-EF1a-FLuc-WPRE-HGHpA
(Plasmid #87951)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 87951 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pAAV with AAV2 ITRs
  • Total vector size (bp) 6983
  • Vector type
    AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Growth instructions
    Need to check ITR presence and orientation every time you amplify to ensure the ITRs haven't recombined. Perform a restriction digest with XmaI (only cuts in the ITRs, should produce two bands of approximate sizes 2.7kb and 4.2kb)
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Firefly Luciferase
  • Alt name
    FLuc
  • Species
    Photinus pyralis
  • Insert Size (bp)
    1653
  • Promoter EF1a

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI, NcoI, MreI (unknown if destroyed)
  • 3′ cloning site EcoRI, EcoRV (unknown if destroyed)
  • 5′ sequencing primer GGGTTTTATGCGATGGAGTTTC
  • 3′ sequencing primer AGGTGCCTAAAGGACTGACC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-EF1a-FLuc-WPRE-HGHpA was a gift from Mark Kay (Addgene plasmid # 87951 ; http://n2t.net/addgene:87951 ; RRID:Addgene_87951)
  • For your References section:

    Bioengineered AAV Capsids with Combined High Human Liver Transduction In Vivo and Unique Humoral Seroreactivity. Paulk NK, Pekrun K, Zhu E, Nygaard S, Li B, Xu J, Chu K, Leborgne C, Dane AP, Haft A, Zhang Y, Zhang F, Morton C, Valentine MB, Davidoff AM, Nathwani AC, Mingozzi F, Grompe M, Alexander IE, Lisowski L, Kay MA. Mol Ther. 2017 Sep 25. pii: S1525-0016(17)30437-9. doi: 10.1016/j.ymthe.2017.09.021. 10.1016/j.ymthe.2017.09.021 PubMed 29055620