pAAV-EF1a-FLuc-WPRE-HGHpA
(Plasmid #87951)

• Purpose: Recombinant single-stranded AAV transfer vector expressing Firefly Luciferase under the EF1a promoter
• Depositing Lab: Mark Kay
• Publication: Paulk et al Mol Ther. 2017 Sep 25. pii: S1525-0016(17)30437-9. doi: 10.1016/j.ymthe.2017.09.021.

Backbone

• Vector backbone: pAAV with AAV2 ITRs
• Total vector size (bp): 6983
• Vector type: AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Growth instructions: Need to check ITR presence and orientation every time you amplify to ensure the ITRs haven't recombined. Perform a restriction digest with XmaI (only cuts in the ITRs, should produce two bands of approximate sizes 2.7kb and 4.2kb)
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Firefly Luciferase
• Alt name: FLuc
• Species: Photinus pyralis
• Insert Size (bp): 1653
• Promoter: EF1a

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: KpnI, NcoI, MreI (unknown if destroyed)
• 3′ cloning site: EcoRI, EcoRV (unknown if destroyed)
• 5′ sequencing primer: GGGTTTTATGCGATGGAGTTTC
• 3′ sequencing primer: AGGTGCCTAAAGGACTGACC

Resource Information

• Supplemental Documents:
  • pAAV-EF1a-FLuc.gb
• Articles Citing this Plasmid:
  • 4 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Luciferase Limited Use Label License
• Industry Terms:
  • Not Available to Industry