pHES873
(Plasmid
#87945)
-
PurposeExpresses estradiol-inducible synthetic transcription factor in yeast under control of GAL1 promoter. It activates transcription of promoters containing Zif268 binding sites.
-
Depositing Lab
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 87945 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backbonepAAD606
- Backbone size w/o insert (bp) 7000
- Total vector size (bp) 9109
-
Vector typeYeast Expression
-
Selectable markersURA3
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namepGAL1- Zif268 DBD - hPR LBD - MSN2 AD
-
Alt nameZPM
-
SpeciesH. sapiens (human), S. cerevisiae (budding yeast)
-
Insert Size (bp)2745
-
Entrez GenePGR (a.k.a. NR3C3, PR)
- Promoter GAL1
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site PspOMI (not destroyed)
- 3′ cloning site SacI (not destroyed)
- 5′ sequencing primer GTGGATTCGGCTTTGGGTA
- 3′ sequencing primer CGCACTCACGTAAACACTTAATC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHES873 was a gift from Hana El-Samad (Addgene plasmid # 87945 ; http://n2t.net/addgene:87945 ; RRID:Addgene_87945) -
For your References section:
Robust Synthetic Circuits for Two-Dimensional Control of Gene Expression in Yeast. Aranda-Diaz A, Mace K, Zuleta I, Harrigan P, El-Samad H. ACS Synth Biol. 2016 Dec 27. doi: 10.1021/acssynbio.6b00251. 10.1021/acssynbio.6b00251 PubMed 27930885
Map uploaded by the depositor.
