pHES795
(Plasmid #87943)

• Purpose: Constitutively expresses estradiol-inducible synthetic transcription factor in yeast. It activates transcription of promoters containing Zif268 binding sites.
• Depositing Lab: Hana El-Samad
• Publication: Aranda-Diaz et al ACS Synth Biol. 2016 Dec 27. doi: 10.1021/acssynbio.6b00251.

Backbone

• Vector backbone: pAAD606
• Backbone size w/o insert (bp): 7000
• Total vector size (bp): 9173
• Vector type: Yeast Expression
• Selectable markers: URA3

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Zif268 DBD - hER LBD - MSN2 AD
• Alt name: ZEM
• Species: H. sapiens (human), S. cerevisiae (budding yeast), Synthetic
• Insert Size (bp): 2173
• Entrez Gene: ESR1 (a.k.a. ER, ESR, ESRA, ESTRR, Era, NR3A1)
• Promoter: ADH1 (crippled)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: PspOMI (not destroyed)
• 3′ cloning site: SacI (not destroyed)
• 5′ sequencing primer: GTGGATTCGGCTTTGGGTA
• 3′ sequencing primer: CGCACTCACGTAAACACTTAATC

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry