AAV-U6-sgRNA-hSyn-mCherry
(Plasmid #87916)

• Purpose: sgRNA expressing AAV construct with a mCherry reporter driven by hSyn promoter. (replaced the GFP in pX552 from Zhang lab with mCherry)
• Depositing Lab: Alex Hewitt
• Publication: Hung et al Invest Ophthalmol Vis Sci. 2016 Jun 1;57(7):3470-6. doi: 10.1167/iovs.16-19316.

Backbone

• Vector backbone: pX552
• Backbone manufacturer: Feng Zhang lab
• Total vector size (bp): 5291
• Vector type: Mammalian Expression, AAV, CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: mCherry
• gRNA/shRNA sequence: SapI cloning site
• Promoter: hSyn

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: SalI (not destroyed)
• 3′ cloning site: BspEI (not destroyed)
• 5′ sequencing primer: ctgcgtatgagtgcaagtgggtt

Resource Information

• A portion of this plasmid was derived from a plasmid made by: pAAV-minCMV-mCherry (Addgene#27970)
• Articles Citing this Plasmid:
  • 7 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry