pENTR221-H1-sgGFP1-U6-sgGFP2-7SK-sgGFP3
(Plasmid
#87906)
-
PurposesgRNA targeting GFP
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 87906 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepENTR221
-
Backbone manufacturerThermofisher
- Backbone size w/o insert (bp) 2600
- Total vector size (bp) 3684
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesgGFP1, sgGFP2, sgGFP3
-
Insert Size (bp)1088
- Promoter H1, U6, 7SK
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer CCCAGTCACGACGTTGTAAAACG
- 3′ sequencing primer GTAACATCAGAGATTTTGAGACAC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pENTR221-H1-sgGFP1-U6-sgGFP2-7SK-sgGFP3 was a gift from Nicole Déglon (Addgene plasmid # 87906 ; http://n2t.net/addgene:87906 ; RRID:Addgene_87906) -
For your References section:
The Self-Inactivating KamiCas9 System for the Editing of CNS Disease Genes. Merienne N, Vachey G, de Longprez L, Meunier C, Zimmer V, Perriard G, Canales M, Mathias A, Herrgott L, Beltraminelli T, Maulet A, Dequesne T, Pythoud C, Rey M, Pellerin L, Brouillet E, Perrier AL, du Pasquier R, Deglon N. Cell Rep. 2017 Sep 19;20(12):2980-2991. doi: 10.1016/j.celrep.2017.08.075. 10.1016/j.celrep.2017.08.075 PubMed 28930690