pENTR4-Cas9-V5
(Plasmid
#87905)
-
PurposeCloning vector
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 87905 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepENTR4-dual selection
-
Backbone manufacturerThermofisher
- Backbone size w/o insert (bp) 2280
- Total vector size (bp) 6468
-
Vector typecloning vector
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCas9-V5
-
Alt nameCas9
-
SpeciesStreptococcus pyogenes
-
Insert Size (bp)4188
-
MutationHuman codon optimized
- Promoter V5
-
Tag
/ Fusion Protein
- V5 (C terminal on insert)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer xx
- 3′ sequencing primer GTAACATCAGAGATTTTGAGACAC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byhCas9 from addgene plasmid #41815
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pENTR4-Cas9-V5 was a gift from Nicole Déglon (Addgene plasmid # 87905 ; http://n2t.net/addgene:87905 ; RRID:Addgene_87905) -
For your References section:
The Self-Inactivating KamiCas9 System for the Editing of CNS Disease Genes. Merienne N, Vachey G, de Longprez L, Meunier C, Zimmer V, Perriard G, Canales M, Mathias A, Herrgott L, Beltraminelli T, Maulet A, Dequesne T, Pythoud C, Rey M, Pellerin L, Brouillet E, Perrier AL, du Pasquier R, Deglon N. Cell Rep. 2017 Sep 19;20(12):2980-2991. doi: 10.1016/j.celrep.2017.08.075. 10.1016/j.celrep.2017.08.075 PubMed 28930690