Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

SIN-PGK-Cas9-WPRE
(Plasmid #87886)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 87886 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    HIV-1 lentiviral SIN transfer vector
  • Backbone size w/o insert (bp) 7500
  • Total vector size (bp) 13114
  • Vector type
    Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    hCas9
  • Alt name
    Cas9
  • Species
    Streptococcus pyogenes
  • Insert Size (bp)
    4140
  • Mutation
    Human codon-optimized
  • Promoter mouse PGK
  • Tag / Fusion Protein
    • nls (C terminal on insert)

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer TGCACGCTTCAAAAGCGC
  • 3′ sequencing primer AGCAGCGTATCCACATAGCGTAAAAGGAGC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    hCas9 from addgene plasmid #41815

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    SIN-PGK-Cas9-WPRE was a gift from Nicole Déglon (Addgene plasmid # 87886 ; http://n2t.net/addgene:87886 ; RRID:Addgene_87886)
  • For your References section:

    The Self-Inactivating KamiCas9 System for the Editing of CNS Disease Genes. Merienne N, Vachey G, de Longprez L, Meunier C, Zimmer V, Perriard G, Canales M, Mathias A, Herrgott L, Beltraminelli T, Maulet A, Dequesne T, Pythoud C, Rey M, Pellerin L, Brouillet E, Perrier AL, du Pasquier R, Deglon N. Cell Rep. 2017 Sep 19;20(12):2980-2991. doi: 10.1016/j.celrep.2017.08.075. 10.1016/j.celrep.2017.08.075 PubMed 28930690