pFC333
(Plasmid #87844)

• Purpose: AMA1 plasmid with Aspergillus optimized Cas9 and ble selection marker
• Depositing Lab: Uffe Mortensen
• Publication: Nodvig et al PLoS One. 2015 Jul 15;10(7):e0133085. doi: 10.1371/journal.pone.0133085. eCollection 2015.

Backbone

• Vector backbone: custom
• Total vector size (bp): 15667
• Vector type: Bacterial Expression, CRISPR ; Fungal expression
• Selectable markers: Zeocin ; bleomycin, phleomycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert 1

• Gene/Insert name: Cas9
• Species: Synthetic; synthetic gene, codon optimized for A. niger
• Insert Size (bp): 4131
• GenBank ID: KT031983
• Promoter: Aspergillus nidulans tef1 promoter
• Tag / Fusion Protein:
  • SV40 NLS (C terminal on insert)

Cloning Information for Gene/Insert 1

• Cloning method: Unknown
• 5′ sequencing primer: CTTCTCTGCTCAGCACCTCTACG

Gene/Insert 2

• Gene/Insert name: ble (bleomycin resistance marker)
• Insert Size (bp): 375
• Promoter: Aspergillus nidulans trpC promoter

Cloning Information for Gene/Insert 2

• Cloning method: Unknown
• 5′ sequencing primer: GCTAGTGGAGGTCAACACATCAATGC

Resource Information

• Supplemental Documents:
  • pFC333.gbk
• A portion of this plasmid was derived from a plasmid made by: The cas9 genes contained in the vectors are custom made versions that we bought from GenScript.
• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry