-
PurposeAMA1 plasmid with Aspergillus optimized Cas9 and pyrG selection marker
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 87842 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonecustom
- Total vector size (bp) 15764
-
Modifications to backboneAMA1 element
-
Vector typeBacterial Expression, CRISPR ; Fungal expression
-
Selectable markerspyrG
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert nameCas9
-
SpeciesSynthetic; synthetic gene, codon optimized for A. niger
-
Insert Size (bp)4131
-
GenBank IDKT031983
- Promoter Aspergillus nidulans tef1 promoter
-
Tag
/ Fusion Protein
- SV40 NLS (C terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Unknown
- 5′ sequencing primer CTTCTCTGCTCAGCACCTCTACG (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namepyrG
-
SpeciesAspergillus fumigatus
-
Insert Size (bp)905
- Promoter native promoter
Cloning Information for Gene/Insert 2
- Cloning method Unknown
- 5′ sequencing primer TCCTCGTGTACTGTGTAAGCGCCC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byThe cas9 genes contained in the vectors are custom made versions that we bought from GenScript.
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pFC330 was a gift from Uffe Mortensen (Addgene plasmid # 87842 ; http://n2t.net/addgene:87842 ; RRID:Addgene_87842) -
For your References section:
A CRISPR-Cas9 System for Genetic Engineering of Filamentous Fungi. Nodvig CS, Nielsen JB, Kogle ME, Mortensen UH. PLoS One. 2015 Jul 15;10(7):e0133085. doi: 10.1371/journal.pone.0133085. eCollection 2015. PONE-D-15-11561 [pii] PubMed 26177455