TLCV2-RB1
(Plasmid #87836)

• Purpose: LentiCRISPR v2 was modified into an all-in-one dox inducible system. The addition of doxycycline induces Cas9-2A-eGFP. The U6 promoter drives constitutive expression of an sgRNA targeting human RB1.
• Depositing Lab: Adam Karpf
• Publication: Barger et al Cancers (Basel). 2019 Feb 21;11(2). pii: cancers11020251. doi: 10.3390/cancers11020251.

Backbone

• Vector backbone: TLCV2
• Total vector size (bp): 14873
• Vector type: Mammalian Expression, Lentiviral, CRISPR ; Doxycycline inducible; eGFP reporter
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: sgRB1
• Alt name: RB1, RB, RB Transcriptional Corepressor 1
• gRNA/shRNA sequence: GCTCTGGGTCCTCCTCAGGA
• Species: H. sapiens (human)
• GenBank ID: NM_000321
• Entrez Gene: RB1 (a.k.a. OSRC, PPP1R130, RB, p105-Rb, p110-RB1, pRb, pp110)
• Promoter: U6

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BsmBI (destroyed during cloning)
• 3′ cloning site: BsmBI (destroyed during cloning)
• 5′ sequencing primer: human U6-F GAGGGCCTATTTCCCATGATT

Resource Information

• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The sgRNA targeting RB1 (sgRB#1) was previously published - Nicolay BN, et al. Proteomic analysis of pRb loss highlights a signature of decreased mitochondrial oxidative phosphorylation. Genes Dev. 2015;29(17):1875–1889. The oligos corresponding to sgRB#1 were ordered then annealed and ligated into TLCV2.