pcDNA5-EGFP-NLS-P2A-mCherry-PTS1
(Plasmid #87803)

• Purpose: Mammalian expression vector template for co-expression of EGFP-tagged and mCherry-tagged proteins using P2A. NLS and PTS1 can be replaced by proteins of interest.
• Depositing Lab: Andrea Musacchio
• Publication: Pan et al Elife. 2017 Jan 6;6. pii: e23352. doi: 10.7554/eLife.23352.

Backbone

• Vector backbone: pcDNA5/FRT/TO
• Backbone manufacturer: Thermo Fisher Scientific
• Backbone size w/o insert (bp): 5137
• Total vector size (bp): 6632
• Vector type: Mammalian Expression
• Selectable markers: Hygromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: NLS
• Alt name: nuclear localization signal of SV40 large T antigen
• Species: Synthetic
• Insert Size (bp): 21
• GenBank ID: none
• Promoter: CMV promoter, tetracycline operator
• Tag / Fusion Protein:
  • EGFP (N terminal on insert)

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: XhoI (not destroyed)
• 5′ sequencing primer: CAACGAGAAGCGCGATC
• 3′ sequencing primer: GTCACCTTCAGCTTGGCG

Gene/Insert 2

• Gene/Insert name: PTS1
• Alt name: peroxisomal targeting signal 1
• Species: Synthetic
• Insert Size (bp): 15
• GenBank ID: none
• Promoter: CMV promoter, tetracycline operator
• Tag / Fusion Protein:
  • mCherry (N terminal on insert)

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: NheI (not destroyed)
• 3′ cloning site: XmaI (not destroyed)
• 5′ sequencing primer: CAAGTTGGACATCACCTCCCAC
• 3′ sequencing primer: CACCTACTCAGACAATGCGATG

Resource Information

• Supplemental Documents:
  • pCDNA5-EGFP-NLS-P2A-mCherry-PTS1.gb
• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

No stop codon should be placed at the 3' end of the first insert for proper co-expression using 2A-peptide.

Please cite: Pan D, Klare K, Petrovic A, Take A, Walstein K, Singh P, Rondelet A, Bird AW, Musacchio A (2017) CDK-regulated dimerization of M18BP1 on a Mis18 hexamer is necessary for CENP-A loading. Elife 6. doi: 10.7554/eLife.23352.