Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

tet-pLKO shMKP5.v1 puro
(Plasmid #87792)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 87792 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    Tet PLKO puro
  • Backbone manufacturer
    Plasmid #21915
  • Backbone size w/o insert (bp) 10633
  • Total vector size (bp) 8816
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    shMKP5
  • gRNA/shRNA sequence
    CAAAGGCAAACGACCAATTAT
  • Species
    H. sapiens (human)
  • GenBank ID
    NM_007207.5
  • Entrez Gene
    DUSP10 (a.k.a. MKP-5, MKP5)
  • Promoter TRE tight

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site EcoRI (unknown if destroyed)
  • 5′ sequencing primer GGCAGGGATATTCACCATTATCGTTTCAGA
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    tet-pLKO shMKP5.v1 puro was a gift from Kevin Janes (Addgene plasmid # 87792 ; http://n2t.net/addgene:87792 ; RRID:Addgene_87792)
  • For your References section:

    Profiling Subcellular Protein Phosphatase Responses to Coxsackievirus B3 Infection of Cardiomyocytes. Shah M, Smolko CM, Kinicki S, Chapman ZD, Brautigan DL, Janes KA. Mol Cell Proteomics. 2017 Apr;16(4 suppl 1):S244-S262. doi: 10.1074/mcp.O116.063487. Epub 2017 Feb 7. 10.1074/mcp.O116.063487 PubMed 28174228