Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pCZGY2844
(Plasmid #87760)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 87760 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    Gateway Final LR Clone
  • Backbone size w/o insert (bp) 2900
  • Total vector size (bp) 5085
  • Vector type
    Worm Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Punc-17b-PH-miniSOG
  • Species
    C. elegans (nematode), Synthetic
  • Insert Size (bp)
    2150
  • Promoter Punc-17b
  • Tag / Fusion Protein
    • PH

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer tgtaaaacgacggccagt
  • 3′ sequencing primer caggaaacagctatgaccatg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCZGY2844 was a gift from Andrew Chisholm (Addgene plasmid # 87760 ; http://n2t.net/addgene:87760 ; RRID:Addgene_87760)
  • For your References section:

    Highly efficient optogenetic cell ablation in C. elegans using membrane-targeted miniSOG. Xu S, Chisholm AD. Sci Rep. 2016 Feb 10;6:21271. doi: 10.1038/srep21271. 10.1038/srep21271 PubMed 26861262