pHT-497
(Plasmid
#87756)
-
PurposeBacterial expression vector for producing 6x histidine tagged rat DYRK1A kinase domain (residues 1-497)
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 87756 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepND1 with modified restriction sites
-
Backbone manufacturersee Biochim Biophy Acta. 1990; 1050(1–3): 18–26.
- Backbone size w/o insert (bp) 2217
- Total vector size (bp) 3733
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGene coding for rat DYRK1A kinase domain (residues 1-497)
-
SpeciesR. norvegicus (rat)
-
Insert Size (bp)1516
-
GenBank IDXM_008768565.2
- Promoter T7 RNA polymerase promoter
-
Tag
/ Fusion Protein
- 6X histidine tag (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Cla I (not destroyed)
- 3′ cloning site Xho I (not destroyed)
- 5′ sequencing primer TAATACGACTCACTATAGGGA
- 3′ sequencing primer AATTAACCCTCACTAAAGGGA (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Requires strains with T7 RNA polymerase (e.g. BL21) for expression
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHT-497 was a gift from Yu-Wen Hwang (Addgene plasmid # 87756 ; http://n2t.net/addgene:87756 ; RRID:Addgene_87756)