AAV-U6gRNA1-U6gRNA2-TnT-Cre
(Plasmid #87682)

• Purpose: AAV vector for U6 driven expression of two gRNAs, and cardiomyocyte specific expression of Cre recombinase.
• Depositing Lab: William Pu
• Publication: Guo et al Circ Res. 2017 Mar 29. pii: CIRCRESAHA.116.310283. doi: 10.1161/CIRCRESAHA.116.310283.

Backbone

• Vector backbone: pAAV
• Backbone size w/o insert (bp): 2900
• Total vector size (bp): 5969
• Vector type: AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Growth instructions: Check for recombination between ITRs and U6 promoters before making AAV
• Copy number: Unknown

Gene/Insert 1

• Gene/Insert name: gRNA1
• Insert Size (bp): 102
• Promoter: U6

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: KpnI (not destroyed)
• 3′ cloning site: MluI (not destroyed)
• 5′ sequencing primer: CGGCCGCACGCGCCGGTACC
• 3′ sequencing primer: CAGAAGAGCTCGCTCTTCCG

Gene/Insert 2

• Gene/Insert name: gRNA2
• Insert Size (bp): 102
• Promoter: U6

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: MluI (not destroyed)
• 3′ cloning site: none (destroyed during cloning)
• 5′ sequencing primer: GTGGAATTCCACCTGCTCAG
• 3′ sequencing primer: AGGGACTTCGGGCACAATCG

Gene/Insert 3

• Gene/Insert name: Cre
• Insert Size (bp): 1056
• Promoter: cTnT

Cloning Information for Gene/Insert 3

• Cloning method: Restriction Enzyme
• 5′ cloning site: NheI (not destroyed)
• 3′ cloning site: HindIII (not destroyed)
• 5′ sequencing primer: ACGACTCACTATAGGCTAGC

Resource Information

• Supplemental Documents:
  • AAV-U6gRNA-U6gRNA-TnT-Cre.gbk
• Articles Citing this Plasmid:
  • 3 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry