AAV-U6gRNA1-U6gRNA2-TnT-Cre
(Plasmid #87682)

• Purpose: AAV vector for U6 driven expression of two gRNAs, and cardiomyocyte specific expression of Cre recombinase.
• Depositing Lab: William Pu
• Publication: Guo et al Circ Res. 2017 Mar 29. pii: CIRCRESAHA.116.310283. doi: 10.1161/CIRCRESAHA.116.310283.

Want a viral vector made from this plasmid?

Make a packaging request and we'll get back to you.

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.

• Serotype: Select serotype for details See details about
• Pricing: Select serotype and quantity $ USD for preparation of µL virus + $30 USD for plasmid.
• How this works:
  • Place a request for a quantity of 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
  • Addgene will quickly confirm that we can produce a high-quality prep for you.
  • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
  • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
  • Learn more about our Packaged on Request Service.

Backbone

• Vector backbone: pAAV
• Backbone size w/o insert (bp): 2900
• Total vector size (bp): 5969
• Vector type: AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Growth instructions: Check for recombination between ITRs and U6 promoters before making AAV
• Copy number: Unknown

Gene/Insert 1

• Gene/Insert name: gRNA1
• Insert Size (bp): 102
• Promoter: U6

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: KpnI (not destroyed)
• 3′ cloning site: MluI (not destroyed)
• 5′ sequencing primer: CGGCCGCACGCGCCGGTACC
• 3′ sequencing primer: CAGAAGAGCTCGCTCTTCCG

Gene/Insert 2

• Gene/Insert name: gRNA2
• Insert Size (bp): 102
• Promoter: U6

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: MluI (not destroyed)
• 3′ cloning site: none (destroyed during cloning)
• 5′ sequencing primer: GTGGAATTCCACCTGCTCAG
• 3′ sequencing primer: AGGGACTTCGGGCACAATCG

Gene/Insert 3

• Gene/Insert name: Cre
• Insert Size (bp): 1056
• Promoter: cTnT

Cloning Information for Gene/Insert 3

• Cloning method: Restriction Enzyme
• 5′ cloning site: NheI (not destroyed)
• 3′ cloning site: HindIII (not destroyed)
• 5′ sequencing primer: ACGACTCACTATAGGCTAGC

Resource Information

• Supplemental Documents:
  • AAV-U6gRNA-U6gRNA-TnT-Cre.gbk
• Articles Citing this Plasmid:
  • 3 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry