pBW1997_pExpr-hU6-CRISPR-DECODER
(Plasmid
#87549)
-
PurposeExpresses NGN2, MIAT, ACTC1, and TTN gRNAs in response to combinations of Cre and Flp recombinases
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 87549 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepCAGGS
-
Vector typeMammalian Expression, Cre/Lox, CRISPR, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namegRNAs targeting NGN2, MIAT, ACTC1, TTN
-
gRNA/shRNA sequenceGGCGGTGGCGGGGGAGGAGG (NGN2), GCGCCCATGAAATTTTAATG (MIAT), TGGCGCCCTGCCCTCTGCTG (ACTC1), CCTTGGTGAAGTCTCCTTTG (TTN)
-
SpeciesH. sapiens (human)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBW1997_pExpr-hU6-CRISPR-DECODER was a gift from Wilson Wong (Addgene plasmid # 87549 ; http://n2t.net/addgene:87549 ; RRID:Addgene_87549) -
For your References section:
Large-scale design of robust genetic circuits with multiple inputs and outputs for mammalian cells. . Weinberg BH, Pham NT, Caraballo LD, Lozanoski T, Engel A, Bhatia S, Wong WW. Nat Biotechnol. 2017 Mar 27. doi: 10.1038/nbt.3805. 10.1038/nbt.3805 PubMed 28346402