-
Purposeexpress TBK1 in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 87443 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepEGFPC1
- Backbone size w/o insert (bp) 6890
-
Vector typeMammalian Expression
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameTBK1
-
Alt nameTANK-binding kinase 1
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)2191
-
Entrez GeneTbk1 (a.k.a. 1200008B05Rik)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SaII (unknown if destroyed)
- 3′ cloning site ApaI (unknown if destroyed)
- 5′ sequencing primer ATGCAGAGCACCTCCAACCATCTGTGGC
- 3′ sequencing primer CTAAAGACAGTCCACATTGCGAAGGCCA (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTBK1 was a gift from Georgios Stathopoulos (Addgene plasmid # 87443 ; http://n2t.net/addgene:87443 ; RRID:Addgene_87443) -
For your References section:
Myeloid-derived interleukin-1beta drives oncogenic KRAS-NF-kappaBeta addiction in malignant pleural effusion. Marazioti A, Lilis I, Vreka M, Apostolopoulou H, Kalogeropoulou A, Giopanou I, Giotopoulou GA, Krontira AC, Iliopoulou M, Kanellakis NI, Agalioti T, Giannou AD, Jones-Paris C, Iwakura Y, Kardamakis D, Blackwell TS, Taraviras S, Spella M, Stathopoulos GT. Nat Commun. 2018 Feb 14;9(1):672. doi: 10.1038/s41467-018-03051-z. 10.1038/s41467-018-03051-z PubMed 29445180