pET42b-BE3
(Plasmid #87437)

• Purpose: Expresses BE3-NLS with an N-terminal His Tag (His6) for bacterial expression
• Depositing Lab: David Liu
• Publication: Rees et al Nat Commun. 2017 Jun 6;8:15790. doi: 10.1038/ncomms15790.

Backbone

• Vector backbone: pET_42b
• Backbone size w/o insert (bp): 4983
• Total vector size (bp): 10146
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: BE3
• Alt name: GGS-His6-rAPOBEC1-XTEN-nCas9-GGS-UGI-GGS-NLS
• Species: H. sapiens (human), R. norvegicus (rat); Bacillus phage PBS2
• Insert Size (bp): 5163
• Entrez Gene: Apobec1 (a.k.a. REPR, apobec-1)
• Promoter: T7
• Tag / Fusion Protein:
  • His6 (N terminal on insert)

Cloning Information

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: TAATACGACTCACTATAGGG
• 3′ sequencing primer: GCTAGTTATTGCTCAGCGG

Resource Information

• Supplemental Documents:
  • pHR041_6xHis-Apobec1_nCas9_pET42b Copy.gb
• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry