pIHEU_miniSOG2 T2A H3.3A-EGFP
(Plasmid
#87411)
-
PurposeUAS vector to express Histone 3.3A GFP fusion and miniSOG2 in Drosophila
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 87411 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepIHEU
-
Vector typeInsect Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemini singlet oxygen generator 2
-
Alt nameminiSOG2
-
Insert Size (bp)318
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AscI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer aattgtgctcggcaacagc
- 3′ sequencing primer ggcgcacagaaatgattacaac
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pIHEU_miniSOG2 T2A H3.3A-EGFP was a gift from Xiaokun Shu (Addgene plasmid # 87411 ; http://n2t.net/addgene:87411 ; RRID:Addgene_87411) -
For your References section:
Precision Optogenetic Tool for Selective Single- and Multiple-Cell Ablation in a Live Animal Model System. Makhijani K, To TL, Ruiz-Gonzalez R, Lafaye C, Royant A, Shu X. Cell Chem Biol. 2017 Jan 19;24(1):110-119. doi: 10.1016/j.chembiol.2016.12.010. Epub 2017 Jan 5. 10.1016/j.chembiol.2016.12.010 PubMed 28065655