Skip to main content
Addgene

pcDNA3.1_miniSOG2 T2A H2B-EGFP
(Plasmid #87410)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 87410 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pcDNA3.1
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    mini singlet oxygen generator 2
  • Alt name
    miniSOG2
  • Insert Size (bp)
    318

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer TAGAAGGCACAGTCGAGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA3.1_miniSOG2 T2A H2B-EGFP was a gift from Xiaokun Shu (Addgene plasmid # 87410 ; http://n2t.net/addgene:87410 ; RRID:Addgene_87410)
  • For your References section:

    Precision Optogenetic Tool for Selective Single- and Multiple-Cell Ablation in a Live Animal Model System. Makhijani K, To TL, Ruiz-Gonzalez R, Lafaye C, Royant A, Shu X. Cell Chem Biol. 2017 Jan 19;24(1):110-119. doi: 10.1016/j.chembiol.2016.12.010. Epub 2017 Jan 5. 10.1016/j.chembiol.2016.12.010 PubMed 28065655