pBabe-PI(WT)-Src(WT)-mCherry
(Plasmid #87356)

• Purpose: PI(WT): Photo-inhibitable/blue light sensitive ; WT: wild type
• Depositing Lab: Klaus Hahn
• Publication: Dagliyan et al Science. 2016 Dec 16;354(6318):1441-1444.

Backbone

• Vector backbone: pBABE
• Backbone size w/o insert (bp): 5371
• Total vector size (bp): 8131
• Vector type: Mammalian Expression, Bacterial Expression
• Selectable markers: Hygromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: LOV2
• Species: Synthetic
• Insert Size (bp): 447
• Promoter: CMV
• Tag / Fusion Protein:
  • mCherry (N terminal on backbone)

Cloning Information for Gene/Insert 1

• Cloning method: Unknown
• 5′ sequencing primer: aagtatcgggccctttgtgc
• 3′ sequencing primer: CACCTTCAGCTTGGCGGTCTG

Gene/Insert 2

• Gene/Insert name: Src
• Alt name: Rous sarcoma oncogene
• Species: M. musculus (mouse)
• Insert Size (bp): 2031
• GenBank ID: 20779 20779
• Entrez Gene: Src (a.k.a. pp60c-src)
• Promoter: CMV

Cloning Information for Gene/Insert 2

• Cloning method: Unknown
• 5′ sequencing primer: AAGTTCTTTTGCCGCCTCATC
• 3′ sequencing primer: CACCTTCAGCTTGGCGGTCTG

Resource Information

• Supplemental Documents:
  • 1736.gb
• Articles Citing this Plasmid:
  • 3 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry