pSHS248
(Plasmid
#87354)
-
PurposeS867C/N1054C in cysteine-free (C80S/C574S) S. pyogenes Cas9 expression plasmid, HNH-2 FRET construct
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 87354 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepCT10
- Backbone size w/o insert (bp) 6000
- Total vector size (bp) 10000
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCas9
-
SpeciesS. pyogenes
-
Insert Size (bp)4100
-
MutationC80S/C574S/S867C/N1054C
- Promoter T7
-
Tag
/ Fusion Protein
- His-MBP (N terminal on backbone)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer CGCAGACTAATTCGAGCTCG
- 3′ sequencing primer GAAAGGAAGCTGAGTTGGCTG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bySternberg et al.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSHS248 was a gift from Jennifer Doudna (Addgene plasmid # 87354 ; http://n2t.net/addgene:87354 ; RRID:Addgene_87354) -
For your References section:
Conformational control of DNA target cleavage by CRISPR-Cas9. Sternberg SH, LaFrance B, Kaplan M, Doudna JA. Nature. 2015 Nov 5;527(7576):110-3. doi: 10.1038/nature15544. Epub 2015 Oct 28. 10.1038/nature15544 PubMed 26524520