pUC19-Trigger-Bottom
(Plasmid #87317)

• Purpose: Expresses the "Bottom" transcript of the Split-Broccoli system downstream of an RNA Toehold switch Trigger sequence.
• Depositing Lab: Donald Burke
• Publication: Alam et al ACS Synth Biol. 2017 May 26. doi: 10.1021/acssynbio.7b00059.

Backbone

• Vector backbone: pUC19
• Backbone size w/o insert (bp): 2686
• Total vector size (bp): 2968
• Vector type: Bacterial Expression, Synthetic Biology

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Split-Broccoli "Bottom" transcript downstream of RNA Trigger (TS2_AT01)
• Species: Synthetic
• Insert Size (bp): 287
• Promoter: P70a

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XmaI (not destroyed)
• 3′ cloning site: XbaI (not destroyed)
• 5′ sequencing primer: TGTCGGGGCTGGCTTAAC
• 3′ sequencing primer: GCTATGACCATGATTACGCCAAG

Resource Information

• Supplemental Documents:
  • pUC19-Trigger-Bottom annotated plasmid map (.ape file)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry