Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pUC19-T7-3WJdB-T
(Plasmid #87308)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 87308 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pUC19
  • Backbone size w/o insert (bp) 2686
  • Total vector size (bp) 2914
  • Vector type
    Bacterial Expression, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Three-way junction dimeric Broccoli aptamer
  • Alt name
    3WJdB
  • Species
    Synthetic
  • Insert Size (bp)
    233
  • Promoter T7

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XbaI (not destroyed)
  • 3′ cloning site XmaI (not destroyed)
  • 5′ sequencing primer GCTATGACCATGATTACGCCAAG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pUC19-T7-3WJdB-T was a gift from Donald Burke (Addgene plasmid # 87308 ; http://n2t.net/addgene:87308 ; RRID:Addgene_87308)
  • For your References section:

    A Fluorescent Split Aptamer for Visualizing RNA-RNA Assembly In Vivo. Alam KK, Tawiah KD, Lichte MF, Porciani D, Burke DH. ACS Synth Biol. 2017 May 26. doi: 10.1021/acssynbio.7b00059. 10.1021/acssynbio.7b00059 PubMed 28548488