pGADT7 Hsh155 N295D
(Plasmid
#87294)
-
PurposeEncodes Y2H Gal4 activation domain for Hsh155 N295D
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 87294 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepGADT7
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 7987
- Total vector size (bp) 10910
-
Vector typeBacterial Expression, Yeast Expression
-
Selectable markersLEU2
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameHSH155
-
SpeciesS. cerevisiae (budding yeast)
-
Insert Size (bp)2923
-
MutationN295D
-
GenBank IDNP_014015.1
-
Entrez GeneHSH155 (a.k.a. YMR288W)
-
Tag
/ Fusion Protein
- GAL4 AD (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XmaI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer CCAGTGAATTCCACCCGGGAATGAGTCATCCGATTCAATTTG
- 3′ sequencing primer GCTCGAGCTCGATGGATCCTCACAGAACTAAATCCAGTTCTTC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGADT7 Hsh155 N295D was a gift from Aaron Hoskins (Addgene plasmid # 87294 ; http://n2t.net/addgene:87294 ; RRID:Addgene_87294) -
For your References section:
SF3b1 mutations associated with myelodysplastic syndromes alter the fidelity of branchsite selection in yeast. Carrocci TJ, Zoerner DM, Paulson JC, Hoskins AA. Nucleic Acids Res. 2017 Jan 6. pii: gkw1349. doi: 10.1093/nar/gkw1349. 10.1093/nar/gkw1349 PubMed 28062854