Skip to main content
Addgene

P823_eSpCas9(1.1)-RecA
(Plasmid #87264)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 87264 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    eSpCas9(1.1)
  • Backbone size w/o insert (bp) 8692
  • Total vector size (bp) 9805
  • Modifications to backbone
    Human codon-optimized RecA coding sequences were fused to the eSpCas9(1.1) protein.
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    RecA
  • Promoter CBh
  • Tag / Fusion Protein
    • FLAG (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site BsrGI (not destroyed)
  • 5′ sequencing primer TGCTGGACGCCACCCTGATC
  • 3′ sequencing primer GAACCAAGCATGTCAAGGTC
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    P823_eSpCas9(1.1)-RecA was a gift from Yonglun Luo (Addgene plasmid # 87264 ; http://n2t.net/addgene:87264 ; RRID:Addgene_87264)

  • For your References section:

    Fusion of SpCas9 to E. coli Rec A protein enhances CRISPR-Cas9 mediated gene knockout in mammalian cells. Lin L, Petersen TS, Jensen KT, Bolund L, Kuhn R, Luo Y. J Biotechnol. 2017 Mar 1;247:42-49. doi: 10.1016/j.jbiotec.2017.02.024. 10.1016/j.jbiotec.2017.02.024 PubMed 28259533
Related items:
Commonly requested with: