P628_SpCas9-RecA
(Plasmid
#87263)
-
PurposeHuman codon optimized RecA protein was fused to SpCas9 for enhanced genome editing efficiency
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 87263 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonePX459
- Backbone size w/o insert (bp) 8512
- Total vector size (bp) 9613
-
Modifications to backboneHuman codon optimized RecA coding sequencing was inserted into the pSpCas9(BB)-2A-Puro (PX459) vector via the EcoRI cloning site.
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameRecA
-
SpeciesSynthetic; E.Coli
-
Insert Size (bp)1101
-
Mutationno
- Promoter CBh
-
Tag
/ Fusion Protein
- FLAG (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer TGCTGGACGCCACCCTGATC
- 3′ sequencing primer AACAGATGGCTGGCAACTAG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
P628_SpCas9-RecA was a gift from Yonglun Luo (Addgene plasmid # 87263 ; http://n2t.net/addgene:87263 ; RRID:Addgene_87263) -
For your References section:
Fusion of SpCas9 to E. coli Rec A protein enhances CRISPR-Cas9 mediated gene knockout in mammalian cells. Lin L, Petersen TS, Jensen KT, Bolund L, Kuhn R, Luo Y. J Biotechnol. 2017 Mar 1;247:42-49. doi: 10.1016/j.jbiotec.2017.02.024. 10.1016/j.jbiotec.2017.02.024 PubMed 28259533