AP1297‐1
(Plasmid
#87247)
-
Purposegtbp‐1 (flanking sequence)::eGFP::gtbp‐1 (27bp)::PH::gtbp‐ 1 (flanking sequence)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 87247 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepUC19
- Backbone size w/o insert (bp) 3200
- Total vector size (bp) 4400
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namegtbp‐1 (flanking sequence)::eGFP::gtbp‐1 (27bp)::PH::gtbp‐ 1 (flanking sequence)
-
SpeciesC. elegans (nematode)
-
Insert Size (bp)1200
-
Tag
/ Fusion Protein
- gtbp‐1 (flanking sequence)::eGFP::gtbp‐1 (27bp)::PH::gtbp‐ 1 (flanking sequence)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer tgctgcaaggcgattaagttgg
- 3′ sequencing primer ctttatgcttccggctcgtatg (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AP1297‐1 was a gift from Geraldine Seydoux (Addgene plasmid # 87247 ; http://n2t.net/addgene:87247 ; RRID:Addgene_87247) -
For your References section:
Cas9-assisted recombineering in C. elegans: genome editing using in vivo assembly of linear DNAs. Paix A, Schmidt H, Seydoux G. Nucleic Acids Res. 2016 Sep 6;44(15):e128. doi: 10.1093/nar/gkw502. Epub 2016 Jun 1. 10.1093/nar/gkw502 PubMed 27257074